pcDNA3.1(+)-P2A-eGFP-ORF7b plasmid from GenScript Biotech

Sequence by GenScript Sequence by Depositor

pcDNA3.1(+)-P2A-eGFP-ORF7b

Cat. No.:

MC_0101134

Availability:

5 μg of lyophilized plasmid

Price:

$140

Edit in GenSmart Design

General

Specification

Comments (0)

Keywords	Expression
Vector Backbone	pcDNA3.1(+)-P2A-eGFP
Source	deposit
Depositor	GenScript Biotech
Organization	GenScript Biotech
Description	The plasmid is used for SARS-CoV-2 ORF7b protein expression. The ORF7b protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
Publication

Plasmid Copy	High Copy
Bacterial Resistance	Ampicillin
Growth Strain	DH5-Alpha
Growth Temperature	37°C
Plasmid Size (bp)	6281
Gene/Insert Name	ORF7b
Gene/Insert Sequence	atgattgaactttcattaattgacttctatttgtgctttttagcctttctgctattccttgttttaattatgcttattatcttttggttctcacttgaactgcaagatcataatgaaacttgtcacgcc

*This material may be covered by one or more patents, trademarks and/or copy rights owned or controlled by Depositors or any third parties. This material is available to academic and nonprofit organizations for research use only. Please contact MolecularCloud at plasmid@genscript.com and the Depositor directly if you are from industrial institute or attempt for profit application. This material is not intended to be used therapeutic or diagnostic purposed in humans or animals.

Customers who viewed this item also viewed:

pUC57-2019-nCoV-PC:RdRP

This plasmid contains part of 2019-nCoV(SARS-CoV-2) RdRP gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

pUC57-2019-nCoV-PC:ORF1ab

This plasmid contains part of 2019-nCoV(SARS-CoV-2) ORF1ab and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR

pUC57-2019-nCoV-S(Human)

This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Human expression system)

pUC57-2019-nCoV-S(Insect)

This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Insect expression system)

pcDNA3.1+/C-(K)DYK-ACE2 (NM_021804.2, OHu20260)

Homo sapiens angiotensin I converting enzyme 2 (ACE2), the receptor for 2019-nCoV(SARS-CoV-2).

2019-nCov_pcDNA3.1(+)-P2A-eGFP

The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

2019-nCov-Linker_pcDNA3.1(+)-C-eGFP

The plasmid is used for 2019-nCoV(SARS-CoV-2) surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through linker, which can be used for flow cytometry antibody screening.

pcDNA3.1(+)-P2A-eGFP-ORF10

The plasmid is used for SARS-CoV-2 ORF10 protein expression. The ORF10 protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

pcDNA3.1(+)-P2A-eGFP-ORF8

The plasmid is used for SARS-CoV-2 ORF8 protein expression. The ORF8 protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.

pcDNA3.1(+)-P2A-eGFP-ORF6

The plasmid is used for SARS-CoV-2 ORF6 protein expression. The ORF6 protein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.